View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13770_high_5 (Length: 368)
Name: NF13770_high_5
Description: NF13770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13770_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 29 - 291
Target Start/End: Original strand, 17581908 - 17582161
Alignment:
| Q |
29 |
agcagaatcattgctaaccttcgtaacaaaaacaaatcactggtcatttgataaatatgccaagttagataattttatgatgactgatgagaggtctgtc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17581908 |
agcagaatcattgctaaccttcgtaacaaaaacaaatcactggt--------aaatatgctaagttagataattttatgatgactgatgagaggtctgtc |
17581999 |
T |
 |
| Q |
129 |
cttgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgactgtcggtgtnnnnnnntgtttacagtgaaaggtatatctgaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | | ||||||||||||||||||||||||||| |
|
|
| T |
17582000 |
cttgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgaccgtcgttataaaaaaatgtttacagtgaaaggtatatctgaat |
17582099 |
T |
 |
| Q |
229 |
taaatcaaaataaaaaatgatgatgtccatctcattgctttctcatccaatatggtaactgca |
291 |
Q |
| |
|
||||||||||||||||||||| | || | ||||||||||||||||||||||||||||| |
|
|
| T |
17582100 |
taaatcaaaataaaaaatgat-agttcaagagttttgctttctcatccaatatggtaactgca |
17582161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 320 - 358
Target Start/End: Original strand, 17582163 - 17582201
Alignment:
| Q |
320 |
ccattttggaggttgcccctaagatagcacaggttctgc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17582163 |
ccattttggaggttgcccctaagatagcacaagttctgc |
17582201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 204 - 350
Target Start/End: Complemental strand, 14745292 - 14745143
Alignment:
| Q |
204 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatgatgtccatctcattgctttctcatccaat----atggtaactgcagtctagtc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | || | |||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
14745292 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggt-tcaagagttttgctttctcatgcaatatgcatggtaactgtagtctagtc |
14745194 |
T |
 |
| Q |
300 |
tacctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14745193 |
tacctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
14745143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 185
Target Start/End: Original strand, 53896354 - 53896391
Alignment:
| Q |
148 |
aggcaaggagttttcatcatcaaactgttacgattgac |
185 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
53896354 |
aggcaaggagttttcaccaacaaactgttacgattgac |
53896391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 208 - 236
Target Start/End: Original strand, 53896417 - 53896445
Alignment:
| Q |
208 |
cagtgaaaggtatatctgaattaaatcaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53896417 |
cagtgaaaggtatatctgaattaaatcaa |
53896445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University