View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_100 (Length: 230)
Name: NF13771_high_100
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 36495095 - 36495308
Alignment:
| Q |
1 |
taccttatcggttacttcatctcttccaagaccgaactcctcaggttcgagtcacatactccagcatcttgatttgcgtctttcacggcttagccgacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36495095 |
taccttatcggttacttcatctcttccaagaccgaactcctcaagttcgagtcacatactccagcatcttgatttgcgtctttcacggcttagccgacac |
36495194 |
T |
 |
| Q |
101 |
caaccgtggcttatcagccgccaataataccttgcagaacatcgttcttgacttcagcatcccctacttcatcgccgatctgttacatttcgtcgttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36495195 |
caaccgtggcttatcagccgccaataataccttgcagaacatcgttcttgacttcagcatcccctacttcatcgccgatctgttacatttcgtcattttc |
36495294 |
T |
 |
| Q |
201 |
ctcccaagctacgt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36495295 |
ctcccaagctacgt |
36495308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University