View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13771_high_118 (Length: 202)

Name: NF13771_high_118
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13771_high_118
NF13771_high_118
[»] chr1 (2 HSPs)
chr1 (31-109)||(49404413-49404491)
chr1 (144-185)||(49404342-49404383)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 9e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 31 - 109
Target Start/End: Complemental strand, 49404491 - 49404413
Alignment:
31 ccctttctagtcttcaatggggcatgtgagatttaaaaatttggaaagaaccttcttgttgttattgtagagaagagag 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
49404491 ccctttctagtcttcaatggggcatgtgagatttaaaaatttggaaagaaccttattgttgttattgtagagaagagag 49404413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 49404383 - 49404342
Alignment:
144 taggactgacccagaaaacaagggaggttttcaatggtccta 185  Q
    ||||||||||||||||||||||||||||||||||||||||||    
49404383 taggactgacccagaaaacaagggaggttttcaatggtccta 49404342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University