View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_28 (Length: 424)
Name: NF13771_high_28
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_28 |
 |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 210 - 295
Target Start/End: Complemental strand, 32007208 - 32007123
Alignment:
| Q |
210 |
ccaaaaatgaatctccccgacgatctcttctcttccgaactttccaccgattcacactcttctctcaaaggtaatgctgccttcaa |
295 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32007208 |
ccaaaaatgaatctccccaacgatctcttctcttccgaactttccaccgattcacactcttctctcaaaggtaatgctgtcttcaa |
32007123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 197 - 295
Target Start/End: Complemental strand, 32002298 - 32002201
Alignment:
| Q |
197 |
agaaagcatttatccaaaaatgaatctccccgacgatctcttctcttccgaactttccaccgattcacactcttctctcaaaggtaatgctgccttcaa |
295 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32002298 |
agaaagcatctatccaaaaatgaatcttcc-gacgatctcttctcttccaaactttccaccgagtcacactcttctctcaaaggtaatgctgccttcaa |
32002201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 297 - 371
Target Start/End: Complemental strand, 6444 - 6371
Alignment:
| Q |
297 |
tatgttacagatgattgcaatgtttaagatttgatagttttactaaatatgaatcaaaataagcattgatatgaa |
371 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6444 |
tatgttgcagataattgcaatgtttaagatttgatag-cttactcaatatgaatcaaaataagtattgatatgaa |
6371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 200 - 279
Target Start/End: Complemental strand, 66756 - 66677
Alignment:
| Q |
200 |
aagcatttatccaaaaatgaatctccccgacgatctcttctcttccgaactttccaccgattcacactcttctctcaaag |
279 |
Q |
| |
|
|||||||||||||||| || ||||| | || |||||||||||| | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
66756 |
aagcatttatccaaaactggatctcgctaacaatctcttctcttgccaactttccaccgattcacactcttccctcaaag |
66677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 343 - 386
Target Start/End: Complemental strand, 13175 - 13132
Alignment:
| Q |
343 |
atatgaatcaaaataagcattgatatgaaggacattgatgaatt |
386 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
13175 |
atatgaatcaaaataagtattgatctgaaggacattgatgaatt |
13132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 213 - 284
Target Start/End: Original strand, 9335564 - 9335635
Alignment:
| Q |
213 |
aaaatgaatctccccgacgatctcttctcttccgaactttccaccgat---tcacactcttctctcaaaggtaat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
9335564 |
aaaatgaatctccccgacgatctcttctcatccaaact---caccgattcgtcgcactcttctctcaaaggtaat |
9335635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University