View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_36 (Length: 401)
Name: NF13771_high_36
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 13 - 384
Target Start/End: Complemental strand, 26003009 - 26002642
Alignment:
| Q |
13 |
aatatccccacaatcataatcttcttgtatgcctccatctctttgctcaaactttcactcttaatcagtgtttgtcataataaagtgacagttatatata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26003009 |
aatatccccacaatcataatcttcttgtatgcctccatctctttgctcaaactttcactcttaatcagtgtttgtcataa---agtgacagttatatata |
26002913 |
T |
 |
| Q |
113 |
taggataggatgtgaaactgaacattgttgcaatagtcaataaaatttttatttagaggtgtgcggtggctaatttgcaatactataggttatatatgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26002912 |
taggataggatgtgaaactgaacattgttgcaatagtcaataag-tttttat---gaagtgtgcggtggctaatttgcaatactataggttatatatgct |
26002817 |
T |
 |
| Q |
213 |
ctctaattaagtgaatgaacgtcttcactgttagatttccgtgtggggaaaacttcattatgtctaatggattggaaaagccatgaaacatactataata |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26002816 |
ctctaattaagtgaatgaacgtcttcactgttagattcccgtgtggggaaaatttcataatgtctaatgaataggaaaagccatgaaacatactataata |
26002717 |
T |
 |
| Q |
313 |
cgaacaataatattattgaaa---actaggaagtgtaatatatgtgatgtttcaaaggtgcattcatcggagaat |
384 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26002716 |
cgaacaataatattattgaaaaacactaggaagtgtaatatatgtgatgtttcaaaggtgcattgatcggagaat |
26002642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 117 - 160
Target Start/End: Complemental strand, 26015644 - 26015601
Alignment:
| Q |
117 |
ataggatgtgaaactgaacattgttgcaatagtcaataaaattt |
160 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
26015644 |
ataggatgtaaaattgaacattgtcgcaatagtcaataaaattt |
26015601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 26018869 - 26018828
Alignment:
| Q |
13 |
aatatccccacaatcataatcttcttgtatgcctccatctct |
54 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26018869 |
aatatgcccacaatcataaccttgttgtatgcctccatctct |
26018828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University