View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_43 (Length: 363)
Name: NF13771_high_43
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_43 |
 | |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 344
Target Start/End: Original strand, 36734319 - 36734651
Alignment:
| Q |
18 |
agtaaggaggaggagaaaggaagttggtggaggagaaggtcaaattaaggatctacttgatattttattggatattcttgaagatgagagctctgaaatc |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734319 |
agtaaggaggaggagaaaagaagttggtggaggagaaggtcaaattaaggatctacttgatattttattggatattcttgaagatgagagctctgaaatc |
36734418 |
T |
|
| Q |
118 |
aaattgaaaatggagaacataaaagccttcatcttggtaagtgacaagtgactcagatttacattatatgcac------tcgtattttgattttgttttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36734419 |
aaattgaaaatggagaacataaaagccttcatcttggtaagtgacaagtgactcagatttacattatatgcactctagatcgtattttgattttgttttt |
36734518 |
T |
|
| Q |
212 |
aaaatataattggcgaacttgaaacatgaaacttcttatcttaatctaacagccgtgatcattgattgacttacatagtcgatatctagttgagtctatg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||| ||||| | |
|
|
| T |
36734519 |
aaaatataattggcgaacttgaaacatgaaacttcttatcttgatctaacggccgtgatcattgattgacttaaatagtcgatatctagttacgtctacg |
36734618 |
T |
|
| Q |
312 |
aacaatattgcatttttcttttattcacttata |
344 |
Q |
| |
|
| |||||||||||||| |||||||| ||||||| |
|
|
| T |
36734619 |
accaatattgcattttccttttatttacttata |
36734651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 124
Target Start/End: Original strand, 24587 - 24649
Alignment:
| Q |
62 |
ttaaggatctacttgatattttattggatattcttgaagatgagagctctgaaatcaaattga |
124 |
Q |
| |
|
|||||||| | ||||||||||| ||||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
24587 |
ttaaggatttgcttgatattttgttggaaattcatgaagatgagagcagtgaaataaaattga |
24649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University