View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_45 (Length: 361)
Name: NF13771_high_45
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 79 - 349
Target Start/End: Original strand, 4711068 - 4711338
Alignment:
| Q |
79 |
atcgtgatccttttgtagggtcattaccaatttactcttccattttgggttaattattactcattctagtcattttagaagagataaatgaatcaattta |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
4711068 |
atcgtgatccttttgtagggtaattaccaatttacacttccattttgggttaattattactcattctagtcattttataagagataaatgagtcaattta |
4711167 |
T |
|
| Q |
179 |
ttgtatttggtcagcattttgaataaaatacatcataaactttaattaatccagatggtcatttggttacatgtctattgtccatgacacatgtcatcca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711168 |
ttgtatttggtcagcattttgaataaaatacatcatcaactttaattgacctagatggtcatttggttacatgtctattgtccatgacacatgtcatcca |
4711267 |
T |
|
| Q |
279 |
cccaagtagtgcaaaatcttatcactggttacgtgtctgtcataaacgtatttctatgaattgcatgcttc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711268 |
cccaagtagtgcaaaatcttatcactggttacgtgtctgtcataaacgtatttctatgaattgcatgcttc |
4711338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University