View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_59 (Length: 317)
Name: NF13771_high_59
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 235 - 302
Target Start/End: Original strand, 1716083 - 1716150
Alignment:
| Q |
235 |
caaatatttattgagaaatatatggaggccaaaatagaaattaataaaatttgttggggtggcgtagg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1716083 |
caaatatttattgagaaatatatggaggccaaaatagaaattaataaaatttgttggggtggcgtagg |
1716150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University