View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_70 (Length: 274)
Name: NF13771_high_70
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 52244466 - 52244224
Alignment:
| Q |
18 |
ccccaatgaagctttcgtaaacacactgacaggaaaatgaaaaacttgacatttgacaataagcatccgctgatgttattaatnnnnnnnnatcccagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52244466 |
ccccaatgaagctttcgtaaacacactgacaggaaaatgaaaaacttgacatttgaaaataagcatccgctgatgttattaatggggg---atcccagag |
52244370 |
T |
 |
| Q |
118 |
aggttcttcaattgactcagctagggtttttaatctttcgcctttatgcaattattcctgattatgatatctgaatatattcggtatcaatacattctgg |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52244369 |
agattcttcaattgactcagctagggtttttaatctttcgcctttatgcaattattcctgattatgatatctgaatatattcggtatcaatacattctgg |
52244270 |
T |
 |
| Q |
218 |
ttattgctttaagctctgcagcctatttctatgattttgttgttcat |
264 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52244269 |
ttattgc-ttaagctctgcagcctatttctatgattttgttgttcat |
52244224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University