View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_77 (Length: 259)
Name: NF13771_high_77
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_77 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 6572762 - 6572997
Alignment:
| Q |
1 |
gggacagtgatattgatgcataagaatgttttggatatcaaagccctcacttctggtttaatcaaaggtggaatcaattttcttggtgggatgactagtg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6572762 |
gggacagtgatattgatgcatacgaatgtttaggatatcaacgccctcacttctggtttaatcaaaggtggaatcaattttcttggtggtatgactagtg |
6572861 |
T |
 |
| Q |
101 |
gggcaaa--nnnnnnnnnnnnnnnngaaaatcagtgagacaatatccgtcactttgttactctcgcttttactagctttgtccctaaacagtacttg-aa |
197 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6572862 |
gggcaaattttttaattttttttttgaaaatca------caatatccgtcactttgttactctcgcttttactagctttgtccctaaacagtacttgaaa |
6572955 |
T |
 |
| Q |
198 |
aaaatatcttcttccagtttcaattatacaacaaacagtata |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6572956 |
aaaatatcttcgtccagtttcaattatacaacaaacaatata |
6572997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 6277326 - 6277266
Alignment:
| Q |
1 |
gggacagtgatattgatgcataagaatgttttggatatcaaagccctcacttctggtttaa |
61 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
6277326 |
gggacagtgatattgatgcataggaatgtgttggatatcaacgccctcaccgctggtttaa |
6277266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 6340111 - 6340071
Alignment:
| Q |
1 |
gggacagtgatattgatgcataagaatgttttggatatcaa |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6340111 |
gggacagtgatattgatgcataagaatgtattggatatcaa |
6340071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 126 - 193
Target Start/End: Complemental strand, 9220532 - 9220465
Alignment:
| Q |
126 |
aaatcagtgagacaatatccgtcactttgttactctcgcttttactagctttgtccctaaacagtact |
193 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
9220532 |
aaatcagtgagacaatatcagtcactttgttactctcattgttactagctttgtccctaaacagtact |
9220465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University