View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_80 (Length: 252)
Name: NF13771_high_80
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 32 - 231
Target Start/End: Complemental strand, 36798898 - 36798699
Alignment:
| Q |
32 |
caaaggccttaactaaagtacatgcataaaatacatatatgcatgtttaaattatgtcatatttttcacactcacatattggtagcttcttaatagaaag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798898 |
caaaggccttaactaaagtacatgcataaaatacatatatgcatgtttaaattatgtcatatttttcacactcacatattggtagcttcttaatagaaag |
36798799 |
T |
 |
| Q |
132 |
atgttgcgacagatgagcaggtccacatagtgtgataacaaggcaacatcaaatgcaacaatgatcgtgttgatttttgcagcagtaaacacaacaattg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798798 |
atgttgcgacagatgagcaggtccacatagtgtgataacaaggcaacatcaaatgcaacaatgatcgtgttgatttttgcagcagtaaacacaacaattg |
36798699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University