View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13771_high_95 (Length: 236)

Name: NF13771_high_95
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13771_high_95
NF13771_high_95
[»] chr5 (1 HSPs)
chr5 (113-221)||(8815072-8815180)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 113 - 221
Target Start/End: Original strand, 8815072 - 8815180
Alignment:
113 gaaattgacgcgtcagtccatgaccaataaaaacttttgagtcactcctcacaatacagttagaaatgtgatctttgtcaaggcaactccatgccattaa 212  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
8815072 gaaattgacgcgtcggtccatgaccaataaaaacttttgagtcactcctcacaatacagttagaaatgtgatctttgtcaaggcaactctatgccattaa 8815171  T
213 acatggcct 221  Q
    |||| ||||    
8815172 acattgcct 8815180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University