View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_high_98 (Length: 233)
Name: NF13771_high_98
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_high_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 31567377 - 31567582
Alignment:
| Q |
18 |
aagctcctcaacaacaaatcgttctctcatcttctgcttcttctctaccacctttttctcactgattacaccatcaggaagtggtttatttgtaaaagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31567377 |
aagctcctcaacaacaaatcgttctctcatcttctgcttcttctctaccacctttttctcactgattacaccatcaggaagtggttgatttgtaaaagca |
31567476 |
T |
 |
| Q |
118 |
gaatataaactcctcttttcaatttcaactttctttggaataaccccttttgattttttctgcttaaaatttgtaacttgttctgttaattgatttagtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
31567477 |
gaatataaactcctcttttcaatttcaactttctttggaataaccccttttgattttttctgcttagagtttttaacttgttctgttaattgatttagtt |
31567576 |
T |
 |
| Q |
218 |
tcttct |
223 |
Q |
| |
|
|||||| |
|
|
| T |
31567577 |
tcttct |
31567582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University