View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_114 (Length: 217)
Name: NF13771_low_114
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_114 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 3375413 - 3375592
Alignment:
| Q |
18 |
cataggttgtgaaggatattttgaatgaggtatcattgctaaccatgcagtatcgtaactagaagggcatacaaaattatagagatcaaaattcgatgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3375413 |
cataggttgtgaaggatattttgaatgaggtatcattgctaaccatgcagtatcgtaagtagaagggcatacaaaattatagagatcaaaattcgatgag |
3375512 |
T |
|
| Q |
118 |
aatatatttttctttatcttttgaaccctacgctcaatgcatgataagggaagttccataggaaatatttaagcaaggat |
197 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3375513 |
aatatatttttctttatctttcgaaccctacgctcaatgcatgataagggaagttccataggaaatatttaagcaaggat |
3375592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 3350007 - 3350192
Alignment:
| Q |
18 |
cataggttgtgaaggatattttgaatgaggtatcattgctaaccatgcagtatcgtaactagaagggcatacaaaattatagagatcaaaattcgatgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3350007 |
cataggttgtgaaggatattttgaatgaggtatcattgctaaccatgcagtatcgtaagtagaagggaatacaaaattatagagatcaaaattcgatgag |
3350106 |
T |
|
| Q |
118 |
aatatatttttctttatcttttgaaccctacgctcaatgcatgataagggaagttccataggaaatatttaagcaaggatggatat |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3350107 |
aatatatttttctttatctttcgaaccctacgctcaatgcatgataagggaagttccataggaaatatttaagcaaggttggatat |
3350192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University