View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_120 (Length: 208)
Name: NF13771_low_120
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_120 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 43712139 - 43712308
Alignment:
| Q |
18 |
aataatacttgatgttacgtatcggagggagaggattattttgcatacatacatacatacgtgatttgcatatttatcaaaagtacataatataatcata |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712139 |
aataatacttgatgttacgtataggagg-agaggattattttgcatacatacatacatacgtgatttgcatatttatcaaaagtacataatataatcata |
43712237 |
T |
 |
| Q |
118 |
ttcatgaaatacaatgtgtggacccatatacatacttatataagctcaccccccgcttcattattatgtgcct |
190 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43712238 |
ttcatgaaatacaatgt-cagacccatatacatatttatataagctca-cccccgcttcattattatgtgcct |
43712308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University