View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_123 (Length: 202)
Name: NF13771_low_123
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 9e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 31 - 109
Target Start/End: Complemental strand, 49404491 - 49404413
Alignment:
| Q |
31 |
ccctttctagtcttcaatggggcatgtgagatttaaaaatttggaaagaaccttcttgttgttattgtagagaagagag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49404491 |
ccctttctagtcttcaatggggcatgtgagatttaaaaatttggaaagaaccttattgttgttattgtagagaagagag |
49404413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 49404383 - 49404342
Alignment:
| Q |
144 |
taggactgacccagaaaacaagggaggttttcaatggtccta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49404383 |
taggactgacccagaaaacaagggaggttttcaatggtccta |
49404342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University