View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_24 (Length: 442)
Name: NF13771_low_24
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 3e-89; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 36733670 - 36733450
Alignment:
| Q |
1 |
attggtaaagataatggacttggaggtaacttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733670 |
attggtaaagataatggacttggaggtaacttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaa |
36733571 |
T |
|
| Q |
101 |
gtaagatgtaaccttggtaatcaaccatgttattgtaaccnnnnnnnnngttgtagtaagtaattgaaaatatgttggttacgctgctgaattgtatc-- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733570 |
gtaagatgtaaccttggtaatcaaccatgttattgtaacctttttttt--tagtagtaagtaattgaaaatatgttggttacgctgctgaattgtatcgt |
36733473 |
T |
|
| Q |
199 |
--gtatataagaaggaaaaaact |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36733472 |
atgtatataagaaggaaaaaact |
36733450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 284 - 429
Target Start/End: Complemental strand, 36733429 - 36733284
Alignment:
| Q |
284 |
atcatattcgttatttgatttggaaaaggacgattatgtgttgctctcaannnnnnnnaggaaggccaaggacggcaacatattcttaaaacgtatgact |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733429 |
atcatattcgttatttgatttggaaaaggacgattatgtgttgctctcaagtttttttaggaaggccaaggacggcaacatattcttaaaacgtatgact |
36733330 |
T |
|
| Q |
384 |
gattccaaactaggaagaatataaaatgtcaccgaatgtctgtgtt |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733329 |
gattccaaactaggaagaatataaaatgtcaccgaatgtctgtgtt |
36733284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 234 - 267
Target Start/End: Complemental strand, 36733450 - 36733417
Alignment:
| Q |
234 |
ttatattgtagtttgtgtttgatcatattcgtta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36733450 |
ttatattgtagtttgtgtttgatcatattcgtta |
36733417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University