View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_40 (Length: 375)
Name: NF13771_low_40
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 6e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 10759890 - 10759669
Alignment:
| Q |
15 |
tattacgtagatttcaaaccatgcatatcaactcacttaaatatgtaaataaaa-tctaaatacgcattttggtaattggtatatattaatctaaatata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
10759890 |
tattacgtagatttcaaaccatgcatatcaactcacttaaatatgtaaataaaaatctaaatacgcattttggtaatc--tatatat--------atata |
10759801 |
T |
 |
| Q |
114 |
tatgtgcaatgtataacttttcgtaaatgatatcaagtgaaaataatagtctttggatttaaaatcgggggtcaagattagaaggctcattatctctact |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10759800 |
tatgcgcaatgtataacttttcgtaaatgatatcaagtgaaaataatagtctttggatttaaaatcgggggtcaagattagaaggctcattatctctact |
10759701 |
T |
 |
| Q |
214 |
gtatatgggtttttcaaattctagaatttttg |
245 |
Q |
| |
|
||||||||||||||||||||| | |||||||| |
|
|
| T |
10759700 |
gtatatgggtttttcaaattccaaaatttttg |
10759669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University