View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_48 (Length: 356)
Name: NF13771_low_48
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 16 - 349
Target Start/End: Complemental strand, 41308663 - 41308330
Alignment:
| Q |
16 |
tctaccacaccttgatctaccatcttcagattccaaatcttcttttgtttcttctgtgattgtgaacaaaaaccttggtggaccagggagattatgcaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41308663 |
tctaccacaccttgatctaccatcttcagattccaaatcttcttttgtttcttctgtgattgtgaacaaaaaccttggtggaccagggagattatgcaac |
41308564 |
T |
 |
| Q |
116 |
ctcatcaattccacttccaaactttcttcaccattggatttcaaaagcaaatcttttccatcaacacctaattccaaatcatgttcttgatttgtacctt |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41308563 |
ctcatcaattctacttccaaactttcttcaccattggatttcaaaagcaaatcttttccatcaacacctaattccaaatcatgttcttgatttgtacctt |
41308464 |
T |
 |
| Q |
216 |
ctttctctctaatcacactttcactagtgtttgttgcatgcaaagaacatggtgttttcttccaacacccccaataaaacaccccttttgcataattact |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41308463 |
ctttctctctaatcacactttcactagtgtttgttgcatgcaaagaacatggtgttttcttccaacacccccaataaaacaccccttttgcataattact |
41308364 |
T |
 |
| Q |
316 |
ctgttccatttcaatatctatgtgtgttcatctc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
41308363 |
ctgttccatttcaatatctatgtgtgttcttctc |
41308330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University