View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_51 (Length: 345)
Name: NF13771_low_51
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 104 - 330
Target Start/End: Original strand, 40925078 - 40925304
Alignment:
| Q |
104 |
ttcacaaatatttacctgtgctggttgaaatctggggataatatagagatgaatgtgcaccttaatgaatcaatttacaaaggaatgaatgttgtttatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925078 |
ttcacaaatatttacctgtgctggttgaaatctggggataatatagagatgaatgtgcaccttaatgaatcaatttacaaaggaatgaatgttgtttatg |
40925177 |
T |
 |
| Q |
204 |
cggtgtatgattcattttatatatgatttgtttcattgtaatatctgtaaaatataattgtgcttttcttttggtacagaaagagcgatataattttatc |
303 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925178 |
cgctgtatgattcattttatatatgatttgtttcattgtaatatctgtaaaatataattgtgcttttcttttggtacagaaagagcgatataattttatc |
40925277 |
T |
 |
| Q |
304 |
ttttatattacagaattatgataaatc |
330 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40925278 |
ttttatattacagaattatgataaatc |
40925304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 44
Target Start/End: Original strand, 40924989 - 40925023
Alignment:
| Q |
10 |
gcagaacctgtgatgatttcaattaagactgatat |
44 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40924989 |
gcagaacctgtaatgatttcaattaagactgatat |
40925023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University