View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_66 (Length: 292)
Name: NF13771_low_66
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_66 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 66 - 292
Target Start/End: Complemental strand, 10488860 - 10488634
Alignment:
| Q |
66 |
atcttatttgaatctttgtcccatctttcccacaagaaaatcatattttcatgtgctatcttttatattaactaaccacaaagcaaccattctttttctt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10488860 |
atcttatttgaatctttgtcccatctttcccacaagaaaatcatattttcatgtgctatcttttatattaactaaccacaaagcaaccattctttttctt |
10488761 |
T |
|
| Q |
166 |
ttcacctatttgcaactttttcaaatcatttttactcagttatcacaaagtccccatttttcacttaaactaagtttcttcacaacttcttcaccccgca |
265 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10488760 |
ttcacctttttgcaactttttcaaatcatttttactcagttatcacaaagtccccatttttcacttaaactaagtttcttcacaacttcttcaccccgca |
10488661 |
T |
|
| Q |
266 |
aagctccaccagaccaacaccatactt |
292 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10488660 |
aagctccaccagaccaacaccatactt |
10488634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 10489421 - 10489369
Alignment:
| Q |
18 |
ataagatgaaaaattgagtacaaaatatggtcaaataggtaaccacctatctt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10489421 |
ataagatgaaaaattgagtacaaaatatggtcaaataggtaaccacctatctt |
10489369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University