View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_70 (Length: 280)
Name: NF13771_low_70
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 29296154 - 29295911
Alignment:
| Q |
18 |
aagattctccgatccaacgacttctcttctcttctcgaaacaatccaaatcttcatccaatccaaggatccttcattccaaaccgttttcaaatccctcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29296154 |
aagattctccgatccaacgacttctcttctcttctcgaaacaatccaaatcttcatccaatccaaggatccttcattccaaaccgttttcaaatccctcg |
29296055 |
T |
|
| Q |
118 |
ctcatcattaccctaacgcattcgctttcaagctcgcgaaacttctagaaactcaccctaaactcgagatccgaaacgaagctgtttcgattcttcttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29296054 |
ctcatcattaccctaacgcattcgctttcaagctcgcgaaacttctagaaactcaccctaaactcgagatccgaaacgaagctgtttcgattcttcttca |
29295955 |
T |
|
| Q |
218 |
cattttcaaaaaatctgataaatggaatcctagtatgcttaatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295954 |
cattttcaaaaaatctgataaatggaatcctagtatgcttaatc |
29295911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 103 - 167
Target Start/End: Complemental strand, 29333519 - 29333455
Alignment:
| Q |
103 |
ttttcaaatccctcgctcatcattaccctaacgcattcgctttcaagctcgcgaaacttctagaa |
167 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| || || || || ||||||||| |
|
|
| T |
29333519 |
ttttcaaatcattcgcacatcattaccctaacgcattcgctttgaaacttgcaaagcttctagaa |
29333455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University