View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_73 (Length: 271)
Name: NF13771_low_73
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 4885328 - 4885463
Alignment:
| Q |
1 |
tgatttcttctactcgaccgttgccgtgtactatacggatcacatcaagtgctccacatggtagaatgcaagatatgcaacatcttatgctgtttctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885328 |
tgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagatatgcaacatcttatgctgtttctcat |
4885427 |
T |
|
| Q |
101 |
agtttcttcttctccttttatttcatttaatctcat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885428 |
agtttcttcttctccttttatttcatttaatctcat |
4885463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University