View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_78 (Length: 263)
Name: NF13771_low_78
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 27 - 245
Target Start/End: Original strand, 47097060 - 47097273
Alignment:
| Q |
27 |
ggcaaaagaggggaaactaagagacattcttagccatgacatgatgttgaagttgttaacgatttcattaggtttgagagaatgactatggttggactgt |
126 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| |||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47097060 |
ggcaaaagaagggaaactaagagacattgttagtaatga-----tgttgaagttgttaatgatttcaataggtttgagagaatgactatggttggactgt |
47097154 |
T |
 |
| Q |
127 |
ggtgcttgtgccctaatccaactattaggccatctattgcaaaggtgttgcagatgttggaaggagattctgaagttagtgttccaccattgtttgattg |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47097155 |
ggtgcttgtgtcctaatccaactattaggccatctattgcaaaggtgttgcagatgttggaaggagattctgaagttagtgttccaccattgtttgatgg |
47097254 |
T |
 |
| Q |
227 |
gaaaattttgtaaccaatt |
245 |
Q |
| |
|
| |||||||||||| |||| |
|
|
| T |
47097255 |
gtaaattttgtaactaatt |
47097273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University