View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_84 (Length: 249)
Name: NF13771_low_84
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_84 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 50184452 - 50184697
Alignment:
| Q |
1 |
atttccaaattcttatgcaccatatatgaagggatttaaccattgccgttttgtgaattttggtctgtatttgaacaaaattatgaatacgaaatttggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50184452 |
atttccaaattcttatgcaccatatatgaagggatttaaccattgccattttgtgaattttggtctgtatttgaacaaaattatgaatacgaaatttggc |
50184551 |
T |
|
| Q |
101 |
tttcttctgaggttcaccgtcaaatgtgtttgaagtgcctcagttgaggttgcactggagttgagagacattgaaaatcctgatgtccccacccaaattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50184552 |
tttcttctgaggttcaccgtcaaatgtgtttgaagtgcctcagttgaggttgcactggagttgagagacattgaaaatcctgatgtcccaacccaaattg |
50184651 |
T |
|
| Q |
201 |
cagacttaagtcatccctattaaaatctc--ttttatattcttcga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
50184652 |
cagacttaagtcatccctattaaaatctctattttatattattcga |
50184697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University