View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_85 (Length: 249)
Name: NF13771_low_85
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 159
Target Start/End: Original strand, 16192876 - 16193028
Alignment:
| Q |
7 |
ctgaaatgaataacaaataatgatgatgataattgtttagaacaaatataagactttacttgaagatggtaaggatactcacaatggtggtggagcactt |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16192876 |
ctgaaatgaataagaaataatgatgatgataattgtttaaaacaaatataagactttacttgaagatggtaaggatactcacaatggtggtggagcactt |
16192975 |
T |
 |
| Q |
107 |
agttggtggttcaccctagacatcacctaagaataataatgttaataaaatta |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16192976 |
agttggtggttcaccctagacatcacctaagaataataatgttaataaaatta |
16193028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University