View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_86 (Length: 248)
Name: NF13771_low_86
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 43876404 - 43876634
Alignment:
| Q |
1 |
actgtttttgggtgttgggttgagaattcttgcaattgtttcttccaattttgggtgttgagtttgtgaatgatgcagtggaaaggaccctgttgggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43876404 |
actgtttttgggtgttgggttgagaattcttgcaattgtttcttccaattttgggtgttgagtttgtgaatgatgcagtggaaaggaccctgttgggata |
43876503 |
T |
|
| Q |
101 |
agggtgtggtgaggtcgatttgtatgagatcgataccattctgtttggcgtaatggaggagtgagggttgaatgaagctgtgaactttcttgggttcaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43876504 |
agggtgtggtgaggtcgatttgtatgagatcgataccgttctgtttggcgtaatggaggagtgagggttgaatgaagctgtgaactttcttgggttcaag |
43876603 |
T |
|
| Q |
201 |
agcatagcctacacgagatgctgcatcacct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43876604 |
agcatagcctacacgagatgctgcatcacct |
43876634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University