View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_89 (Length: 241)
Name: NF13771_low_89
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_89 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 24 - 231
Target Start/End: Original strand, 33700936 - 33701149
Alignment:
| Q |
24 |
acatgtatttacattcatgtttgtgtgtctaatgtctatgttcgtatctcatagacaatatctccttagaaggaatgagaccttgttaaatttatttttc |
123 |
Q |
| |
|
|||||| ||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33700936 |
acatgtgtttacattcatgtttgtgtgtgtc---tccatgttcgtatctcatagacaatatctccttagaaggaatgagaccttgttaaatttatttttc |
33701032 |
T |
 |
| Q |
124 |
aacccnnnnnnnnnnnnnng---------ttttgcttaaatagtcatgcatgactatataagcaacttattaaacattcaacgtttcattttctctatat |
214 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
33701033 |
aacccaaaaaaaaaaaacagaaaaaatagttttgcttaaatagtcatgcatgactatataagcaacctattaaacattcaacgtttcattttatctatat |
33701132 |
T |
 |
| Q |
215 |
ttcttccttcatctcac |
231 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
33701133 |
ttcttccttcatgtcac |
33701149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University