View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_90 (Length: 241)
Name: NF13771_low_90
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_90 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 33048936 - 33048729
Alignment:
| Q |
15 |
ctgtgtttatatttaaaataactgcaaaatattgaattcttgttggacgtaagtgtaaaactagtttataccaattgtgcaagatcatcatcatcattac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33048936 |
ctgtgtttatatttaaaataactgcaaaatattgaattcttgttggacataagtgtaaaactagtttataccaattgtgcaagatcatcatcatcattac |
33048837 |
T |
|
| Q |
115 |
tgattgtgatggcaccaatggcatggggatgccagcgtaggccaacctagaggattactgcataggtctaaacgccaatcaattttaaccaaacaaaaat |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33048836 |
tgattgtgatggcgccaatggcatggggatgccagcgtaggccaacctagaggattactgcataggtctaaatgccaatcaattttaaccaaacaaaaat |
33048737 |
T |
|
| Q |
215 |
aatcaact |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
33048736 |
aatcaact |
33048729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 95
Target Start/End: Complemental strand, 17420944 - 17420875
Alignment:
| Q |
26 |
tttaaaataactgcaaaatattgaattcttgttggacgtaagtgtaaaactagtttataccaattgtgca |
95 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||| ||||||||||||||||||||| || || |||||| |
|
|
| T |
17420944 |
tttaaaataactacaaaatattttattctcattgaccgtaagtgtaaaactagtttacactaactgtgca |
17420875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Complemental strand, 13633025 - 13632989
Alignment:
| Q |
25 |
atttaaaataactgcaaaatattgaattcttgttgga |
61 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
13633025 |
atttaaaataactgtaaaatattgaattcttattgga |
13632989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University