View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_96 (Length: 237)
Name: NF13771_low_96
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_96 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 47988966 - 47988748
Alignment:
| Q |
3 |
gagatgaagaaagttgacaaatgcaatattgggtttgaagatgacaaacttccaagcgacgtcgttgtgatatggcttgcgtgtgtccctcgttcagtcg |
102 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47988966 |
gagataaagaaagttgacaaatgcaatattgggtttgaagatgacaaacttccaagcgacgtcgttgtgatatggcttgcgtgtgtccctcgttcagtcg |
47988867 |
T |
 |
| Q |
103 |
ctcttaacaaacaaccccctcccgtgttgatgacatttggtggttgtcattgttaaaaagaggattaccaggttggaataacccgtacaagtcctaaaag |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47988866 |
ctcttaacaaacaaccccctgccgtgttgatgatatttagtggttgtcattgttaaaaagaggattaccaggttggaataacccgtacaagtcctaaaag |
47988767 |
T |
 |
| Q |
203 |
ggcatggccaggttttaaa |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47988766 |
ggcatggccaggttttaaa |
47988748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University