View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13771_low_99 (Length: 236)
Name: NF13771_low_99
Description: NF13771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13771_low_99 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 113 - 221
Target Start/End: Original strand, 8815072 - 8815180
Alignment:
| Q |
113 |
gaaattgacgcgtcagtccatgaccaataaaaacttttgagtcactcctcacaatacagttagaaatgtgatctttgtcaaggcaactccatgccattaa |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8815072 |
gaaattgacgcgtcggtccatgaccaataaaaacttttgagtcactcctcacaatacagttagaaatgtgatctttgtcaaggcaactctatgccattaa |
8815171 |
T |
 |
| Q |
213 |
acatggcct |
221 |
Q |
| |
|
|||| |||| |
|
|
| T |
8815172 |
acattgcct |
8815180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University