View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13772_low_22 (Length: 237)
Name: NF13772_low_22
Description: NF13772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13772_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 127 - 219
Target Start/End: Original strand, 2637878 - 2637970
Alignment:
| Q |
127 |
aacaaaatattcttcttggtccattacattgaccatagtcaaaatcgtttcagtaaaagctgtttctgttggactgtcttgaatgtgatgatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2637878 |
aacaaaatattcttcttggtccattacattgaccatagtcaaaatcgtttcagtaaaagctgattctgttgaactgtcttgaatgtgatgatg |
2637970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 2637765 - 2637832
Alignment:
| Q |
15 |
ataaagatggctgacaactattttttaagnnnnnnntataactactctcaaaaagatattttatgaac |
82 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
2637765 |
ataaagatggctgacaaatattttttaagaaaaaaatataactactctaaaaaagatattttatgaac |
2637832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University