View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13772_low_22 (Length: 237)

Name: NF13772_low_22
Description: NF13772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13772_low_22
NF13772_low_22
[»] chr7 (2 HSPs)
chr7 (127-219)||(2637878-2637970)
chr7 (15-82)||(2637765-2637832)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 127 - 219
Target Start/End: Original strand, 2637878 - 2637970
Alignment:
127 aacaaaatattcttcttggtccattacattgaccatagtcaaaatcgtttcagtaaaagctgtttctgttggactgtcttgaatgtgatgatg 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||    
2637878 aacaaaatattcttcttggtccattacattgaccatagtcaaaatcgtttcagtaaaagctgattctgttgaactgtcttgaatgtgatgatg 2637970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 2637765 - 2637832
Alignment:
15 ataaagatggctgacaactattttttaagnnnnnnntataactactctcaaaaagatattttatgaac 82  Q
    ||||||||||||||||| |||||||||||       |||||||||||| |||||||||||||||||||    
2637765 ataaagatggctgacaaatattttttaagaaaaaaatataactactctaaaaaagatattttatgaac 2637832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University