View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13773_high_18 (Length: 267)

Name: NF13773_high_18
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13773_high_18
NF13773_high_18
[»] chr8 (1 HSPs)
chr8 (145-250)||(31038462-31038567)


Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 145 - 250
Target Start/End: Original strand, 31038462 - 31038567
Alignment:
145 taaatcactttacatataaccaaacatgaactcaatctcttttaagaagcatgaatgaattaaacatgatgttttatcattgatgcatgtaaatttgtaa 244  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31038462 taaatcactttacatgtaaccaaacatgaactcaatctcttttaagaagcatgaatgaattaaacatgatgttttatcattgatgcatgtaaatttgtaa 31038561  T
245 atttct 250  Q
    ||||||    
31038562 atttct 31038567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University