View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13773_high_25 (Length: 238)

Name: NF13773_high_25
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13773_high_25
NF13773_high_25
[»] chr3 (1 HSPs)
chr3 (1-221)||(52141822-52142032)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 52141822 - 52142032
Alignment:
1 ttgctgagtgcaaaagggcagttcatgggaggagcattaactgatctttgcagttatgttatgacaacatcagaagttgaaaattggggactggcgtgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52141822 ttgctgagtgcaaaagggcagttcatgggaggagcattaactgatctttgcagttatgttatgacaacatcagaagttgaaaattggggactggcgtgca 52141921  T
101 cttgaatggctgtctggcctcatcagagcaacaatatgtaatattggaaatggattgtaatttgtaaattgttgttgatgatgtcaacaaagacaactta 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||       ||||||||||||||   ||||||||||||||||||||||    
52141922 cttgaatggctggctggcctcatcagagcaacaatatgtaatattggaaatgga-------ttgtaaattgttgt---tgatgtcaacaaagacaactta 52142011  T
201 aatcactcagagtacaatgcg 221  Q
    |||||||||||||||||||||    
52142012 aatcactcagagtacaatgcg 52142032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University