View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13773_low_12 (Length: 314)
Name: NF13773_low_12
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13773_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 294
Target Start/End: Complemental strand, 54523950 - 54523747
Alignment:
| Q |
90 |
atatgttgatgttctggttcagtttatttaacccctttgtttgttttaatttgggtgattcagtagtgaatacacaagtggatttcctccagcaaggttt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
54523950 |
atatgttgatgttctggttcagtttatttaacccctt-gtttgttttaatttgttggattcaggagtgaagacacaattggattttctccagcaaggttt |
54523852 |
T |
 |
| Q |
190 |
tccaggtaagaatttgttttataaaactgttttgctcttcgcattctaataggattcagttataattctcaaatttgattttgcctgcattgtttgttta |
289 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54523851 |
gccaggtaagaattgtttttataaaactgttttgctcttcaccttctaataggattcatttataattctcaaatttgattttgcctgcattgtttgttta |
54523752 |
T |
 |
| Q |
290 |
catta |
294 |
Q |
| |
|
||||| |
|
|
| T |
54523751 |
catta |
54523747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 54523989 - 54523953
Alignment:
| Q |
20 |
gcatcctattgaattcttgatttgtttgtctctcatt |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54523989 |
gcatcctattgaattcttgatttgtttgtctctcatt |
54523953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University