View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13773_low_18 (Length: 267)
Name: NF13773_low_18
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13773_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 145 - 250
Target Start/End: Original strand, 31038462 - 31038567
Alignment:
| Q |
145 |
taaatcactttacatataaccaaacatgaactcaatctcttttaagaagcatgaatgaattaaacatgatgttttatcattgatgcatgtaaatttgtaa |
244 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31038462 |
taaatcactttacatgtaaccaaacatgaactcaatctcttttaagaagcatgaatgaattaaacatgatgttttatcattgatgcatgtaaatttgtaa |
31038561 |
T |
 |
| Q |
245 |
atttct |
250 |
Q |
| |
|
|||||| |
|
|
| T |
31038562 |
atttct |
31038567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University