View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13773_low_22 (Length: 254)
Name: NF13773_low_22
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13773_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 235
Target Start/End: Complemental strand, 804063 - 803839
Alignment:
| Q |
11 |
tagataatactatagataaaatatgaatgattttgattctttgaatatcaaatagccctgtgcagaagtatctagattcgagaggaaaacgtggcagtag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
804063 |
tagaaaatactatagataaaatatgaatgattttgattctttgaatatcaaatagccctgtgcagaagtatctagattcgagaggaaaacgtggcagtag |
803964 |
T |
|
| Q |
111 |
aaggaatatggtatactttacttaccactnnnnnnnggtaacttccagaaaatgctatcccgggggcgagcgaggatagagaataatctctaataatgat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
803963 |
aaggaatatggtatactttacttaccactaaaaaaaggtaacttccagaaaatgctatcccgggggcgagcgaggatagagaataatctctaataatgat |
803864 |
T |
|
| Q |
211 |
gtcatagtctcatatatgttcacta |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
803863 |
gtcatagtctcatatatgttcacta |
803839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University