View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13773_low_25 (Length: 238)
Name: NF13773_low_25
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13773_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 52141822 - 52142032
Alignment:
| Q |
1 |
ttgctgagtgcaaaagggcagttcatgggaggagcattaactgatctttgcagttatgttatgacaacatcagaagttgaaaattggggactggcgtgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52141822 |
ttgctgagtgcaaaagggcagttcatgggaggagcattaactgatctttgcagttatgttatgacaacatcagaagttgaaaattggggactggcgtgca |
52141921 |
T |
 |
| Q |
101 |
cttgaatggctgtctggcctcatcagagcaacaatatgtaatattggaaatggattgtaatttgtaaattgttgttgatgatgtcaacaaagacaactta |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52141922 |
cttgaatggctggctggcctcatcagagcaacaatatgtaatattggaaatgga-------ttgtaaattgttgt---tgatgtcaacaaagacaactta |
52142011 |
T |
 |
| Q |
201 |
aatcactcagagtacaatgcg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52142012 |
aatcactcagagtacaatgcg |
52142032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University