View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13773_low_29 (Length: 225)
Name: NF13773_low_29
Description: NF13773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13773_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 25059344 - 25059294
Alignment:
| Q |
90 |
tcctcaactgatctacgacgtgttcctcagcttcagaggcgaggacactcg |
140 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25059344 |
tcctcaacaaatccacgacgttttcctcagcttcagaggcgaggacactcg |
25059294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 25093741 - 25093691
Alignment:
| Q |
90 |
tcctcaactgatctacgacgtgttcctcagcttcagaggcgaggacactcg |
140 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25093741 |
tcctcaacaaatccacgacgttttcctcagcttcagaggcgaggacactcg |
25093691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University