View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13774_low_3 (Length: 263)
Name: NF13774_low_3
Description: NF13774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13774_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 32114052 - 32114284
Alignment:
| Q |
14 |
ctttgccccatgatgatccccataaatgagtccgaccaaacaagaaattctaaacacaaaagtctctcaaaatatcaaagtggggtttacannnnnnnaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32114052 |
ctttgccccatgatgatccccataaatgagtccgaccaaacaagaaattctaaacacaaaagtctctcaaaatatcaaagtggggtttacatttttttaa |
32114151 |
T |
|
| Q |
114 |
aggcatgtgtaacatggtgaaa-----gaaccctcgttgatcttttatacttccttcacataaattattatttttaatctttacattattttacaacttg |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32114152 |
aggcatgtgtaacatggtgaaattaaagaaccctcgttaatcttttatacttccttcacataaattattatttttaatctttgcattattttacaacttg |
32114251 |
T |
|
| Q |
209 |
caaaagtctcacttaatattaataagataatca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32114252 |
caaaagtctcacttaatattaataagataatca |
32114284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University