View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13775_high_13 (Length: 345)
Name: NF13775_high_13
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13775_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 327
Target Start/End: Original strand, 3501389 - 3501700
Alignment:
| Q |
16 |
aatatcccaatctagtcaattattttctattaaatctttcatcaactatccattatacaaactattatattttacgcctaactcaacctaaaaattggct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3501389 |
aatatcccaatctagtcaattattttctcttaaatctttcatcaactatccattatacaaactattatattttacgcctaactcaacctaaaaattggct |
3501488 |
T |
 |
| Q |
116 |
tgtaagacaagaattgcttgaatcttaaaaaactaccgaagcaatatatctctaatcaactttggaactcaacacaccctcttgtgcttaggattggaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3501489 |
tgtaagacaagaattgcttgaatcttaaaaaaataccgaagctatatatctctaatcaactttggaactcaacacaccctcttgtgcttaggattggaca |
3501588 |
T |
 |
| Q |
216 |
tctaaagcatgtacattttgatcatgaacaaatgcaggtagaggtggaatgcttatctaagataagctttgataccatcatagaatttcggtcaagtctt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3501589 |
tctaaagcatgtacattttgatcatgaacaaacgcaggtagaggtggaatgcttatctaggataagctttgataccatcatagaatttcggtcaagtctt |
3501688 |
T |
 |
| Q |
316 |
cctcagcctcac |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3501689 |
cctcagcctcac |
3501700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 67 - 152
Target Start/End: Original strand, 3513758 - 3513846
Alignment:
| Q |
67 |
attatacaaactattatattttacgcctaactcaacctaaaa--attggcttgtaagacaagaattgcttgaatcttaaa-aaactacc |
152 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
3513758 |
attatacaaactattagattttgcgcctaactcaacctaaaaagatttgcttgtaaggcaagaattgcttgaatcttaaagaaactacc |
3513846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University