View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13775_high_9 (Length: 421)
Name: NF13775_high_9
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13775_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 4e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 225 - 406
Target Start/End: Original strand, 12952317 - 12952498
Alignment:
| Q |
225 |
agaagaaagaagcgaaaatttcttcatcttcatggaacagacatggcggtgttgttgctccgattgcagtttctcaagcgcggcgggaattcggtaaaga |
324 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
12952317 |
agaagagagaagcgaaaatgtcttcatcttcatggaacagacatggcggtgttgttgctccgattgcagttcagcaagcgcggcaggaattcggtaaaga |
12952416 |
T |
 |
| Q |
325 |
aactcttttttcttccttttctttcctaatttatgtatgattattgagtattatattgtaattcttcaatttagtttctgtg |
406 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12952417 |
aactcttttttcttccttttatttcctaatttatgtatgattattgagtattgtattgtaattcttcaatttagtttctgtg |
12952498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 12952160 - 12952319
Alignment:
| Q |
23 |
cgttagtgtcgttgttccatggcgctatctgtacccagttccgtcgtttctctattttcatctctgatcttctttcagcttcttctccatcggttctcat |
122 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12952160 |
cgttagggtcgttgttccatggcgctatctgtacccagttccgtcgtttctctattttcttctctgatcttctttcagcttcttctccatcgattctcat |
12952259 |
T |
 |
| Q |
123 |
ctaccgtttccgattgatctctcgttttcaaataaatagagatgcaacggtgaagataga |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12952260 |
ataccgtttccgattgatctctcgttttcaaataaatagagatgcaacggtgaagataga |
12952319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University