View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13775_low_16 (Length: 329)
Name: NF13775_low_16
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13775_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 36445268 - 36445350
Alignment:
| Q |
1 |
acattaaagactcacgtagataattgtgtaaataaaaattaaatgaatttttctgaaattaaatataggccaccatgcatgcc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36445268 |
acattaaagactcacgtagataattgtgtaaataaaaattaaatgaagttttctgaaattaaatataggccaccatgcatgcc |
36445350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 286
Target Start/End: Original strand, 36445496 - 36445560
Alignment:
| Q |
222 |
tcattatacagcgacatgtatttgttttttgttttcgaatacatgccaaaactttgtttgtcttc |
286 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36445496 |
tcattatatagcgacatgtatttgttttttgttttcgaatacatgccaaaactttgtttgtcttc |
36445560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 36445422 - 36445469
Alignment:
| Q |
148 |
gaatgtcaatattcatgtttgttggcatctgactagaacggtccaacc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36445422 |
gaatgtcaatattcatgtttgttggcatctgactagaacggtccaacc |
36445469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University