View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13775_low_23 (Length: 278)
Name: NF13775_low_23
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13775_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 127 - 248
Target Start/End: Original strand, 4031117 - 4031244
Alignment:
| Q |
127 |
ctgaaattattgctaatacacaacttgaaattgctaggatctttgcaaatgttaata------ataaagataaagataaagatgttgatgttgattcatc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031117 |
ctgaaattattgctaatacacaacttgaaattgctaggatctttgcaaatgttaataataaagataaagataaagataaagatgttgatgttgattcatc |
4031216 |
T |
 |
| Q |
221 |
attgagaattggaagaagctaatgatat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4031217 |
attgagaattggaagaagctaatgatat |
4031244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University