View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13775_low_23 (Length: 278)

Name: NF13775_low_23
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13775_low_23
NF13775_low_23
[»] chr3 (1 HSPs)
chr3 (127-248)||(4031117-4031244)


Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 127 - 248
Target Start/End: Original strand, 4031117 - 4031244
Alignment:
127 ctgaaattattgctaatacacaacttgaaattgctaggatctttgcaaatgttaata------ataaagataaagataaagatgttgatgttgattcatc 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||    
4031117 ctgaaattattgctaatacacaacttgaaattgctaggatctttgcaaatgttaataataaagataaagataaagataaagatgttgatgttgattcatc 4031216  T
221 attgagaattggaagaagctaatgatat 248  Q
    ||||||||||||||||||||||||||||    
4031217 attgagaattggaagaagctaatgatat 4031244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University