View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13775_low_28 (Length: 239)
Name: NF13775_low_28
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13775_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 41389289 - 41389407
Alignment:
| Q |
1 |
ttaaatcaggccctccattttttgtcctaatacatgtccatgtattggattatatatgaaattcatcctcttgtacgttaaacaggttttctaaatttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41389289 |
ttaaatcaggccctccattttttgtccaaatacatgtccatgtattggattatatatgaaattcatcctcttgtacgttaaacaggttttctaaatttga |
41389388 |
T |
|
| Q |
101 |
tatttgatgcacaaatatg |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41389389 |
tatttgatgcacaaatatg |
41389407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 41389467 - 41389523
Alignment:
| Q |
179 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgatgtcc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41389467 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgaggtcc |
41389523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University