View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13775_low_32 (Length: 204)
Name: NF13775_low_32
Description: NF13775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13775_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 157
Target Start/End: Original strand, 44628243 - 44628383
Alignment:
| Q |
18 |
tatattggttagagtggaattaaacttgaatcccttaaacaaagtctcaagttcaaacattgtggatg-nnnnnnntatacttgagaggtgagatcaact |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44628243 |
tatattggttagagtagaattaaacttgaatcccttaaacaaagtctcaagttcaaacattgtggatgaaaaaaaatatacttgagaggtgagatcaact |
44628342 |
T |
|
| Q |
117 |
taagtcttaatgtgaatacttgccagaaataatatggttat |
157 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44628343 |
taagtcttaatgtgaatacttgccggaaataatatggttat |
44628383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University