View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13776_low_18 (Length: 204)
Name: NF13776_low_18
Description: NF13776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13776_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 48180075 - 48179907
Alignment:
| Q |
19 |
atgtgtctccatgatcactattgttacgtgcgttttagcactgtaccgcaccgaatcaagtattaattggaagtgaaacttaaacattgattgagcacac |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48180075 |
atgtgtctccatgatcactgttgttacgtgcgttttagcactgtaccgcaccgaatcaagtattaattggaagtgaaacttaa-cattgattgagcacac |
48179977 |
T |
 |
| Q |
119 |
acttcataaaatcacgattgaactatagattttgctcatatatttaataactataactatgagttaaagg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48179976 |
acttcataaaatcacgattgaactatagattttgctcatatatttaataactataactatgagttaaagg |
48179907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University