View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13776_low_8 (Length: 316)
Name: NF13776_low_8
Description: NF13776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13776_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 6279915 - 6279724
Alignment:
| Q |
17 |
atattaatttatgaaattaaaggtactttcaaccctttcatttgggtaaatttgagtgcatattaccaatttagtgtttgatgttggataatttcgacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6279915 |
atattaatttatgaaattaaaggtactttcaaccctttcatttgggtaaatttgagtgcatattaccaatttagtgtttgatgttggataatttggacaa |
6279816 |
T |
|
| Q |
117 |
caaaattat-tgaaaatttaaatatctctaaaattgaaactttttggaacacattggtcc-ttttgggtcggtaaatttagtctctaaaatt |
206 |
Q |
| |
|
||||||||| |||||||| |||||||| || ||| |||||||||||| |||||| ||| |||||| ||||| |||||||||||| ||||| |
|
|
| T |
6279815 |
caaaattatcggaaaatttcaatatctccaagattaaaactttttggatcacattaatcctttttggatcggtcaatttagtctctgaaatt |
6279724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University