View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_high_105 (Length: 215)
Name: NF13777_high_105
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_high_105 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 27 - 148
Target Start/End: Original strand, 30347877 - 30347998
Alignment:
| Q |
27 |
ctaatttgtgtctctaagttcttaattgatgtctcagtatttctttgagattcctcatgatttttcgagagagcatcaatgtgaccatgagtagtgttca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30347877 |
ctaatttgtgtctctaagttcttaattgatgtttcagtatttctttgagattcctcatgatttttcgagagagcatcaatgtgaccatgagtagtgttca |
30347976 |
T |
 |
| Q |
127 |
tatgttgggttaggactccttc |
148 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30347977 |
tatgttgggttaggactccttc |
30347998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University