View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13777_high_108 (Length: 201)

Name: NF13777_high_108
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13777_high_108
NF13777_high_108
[»] chr1 (1 HSPs)
chr1 (19-178)||(37919183-37919342)


Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 19 - 178
Target Start/End: Complemental strand, 37919342 - 37919183
Alignment:
19 agatttgatgatgaagcttctggatccaacgattaactcaactgatttctctgtttcattttgtcaaaaatcgcgatacagtgcagcttgaaatagtata 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37919342 agatttgatgatgaagcttctggatccaacgattaactcaactgatttctctgtttcattttgtcaaaaatcgcgatacagtgcagcttgaaatagtata 37919243  T
119 atgcacgaaagtgaatcacacacgatcatagaaaattgtggagtgattttctcggggtat 178  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37919242 atgtacgaaagtgaatcacacacgatcatagaaaattgtggagtgattttctcggggtat 37919183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University